CL2547Contig1
Contig ID CL2547Contig1
Length 543
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2547contig1 sequence.
Clone ID BP917746 BP917733
Sequence
CTCGAACTGAAGGTGTGGTTGACTTCAAATCACGTACTGGGCTAGATTTGACTGGCTTTT
AACTTGGGAGCTGATTCCAGCAGAAGGTTTCTCAGGCAAAACCAGCGGCTTTCTTGTGGA
CACCGTCCTATCAACCATCTTGCTTTGGATGCCATTGGAAAGCGTTGATTGTAGAGCATC
ATGCGGCTTCCCTTTGCTAAGGGACTTCTCACTGTTTAATGAGTCCGAGGCAAACACGGC
CCCGAGTTGTGAGAGGGGAACTTGAAAGGCGTAAGCTCCTGGCATTATTGCTTGTTACTT
CAGGTTGAGCTAGTTTTGTTCCACTTGCTCTTGAAGCCACAGATCCCCTGAAATTCGAGA
GTGGCCTATCGGGCATAGATGTCCGCAGGTTCGGTGGTGGCTCTTGAGAGAACCCTGGGA
GGACTGCTGGATGTGCAACAGGCTGCCGTACTCTGCTAGAAGGGGAGCTAGGACGCGAGG
ATGCAGCACTCTTTGATTGACGTAATGCACTGGTCCTACTCACAGATGATGACCTCATAA
TTG