CL2712Contig1
Contig ID CL2712Contig1
Length 703
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2712contig1 sequence.
Clone ID BP915002 BP915246
Sequence
TTGTTGATCAATATAGAGCTATTTGGCTTTTAGATGCATTGGCCGAGGAAAATCTACCAT
CCATCATCTTTACCCAACCCTCTAGTTGAGCATTCATGCTCAACAATAGCAAAACCTAGG
CAACAAAATTTGGTAGCAACACAAGCCCCACGATGGACTATATCAAAGCCAAAACCATGA
ACAGGAGATATATACAAACCGCCATATCACATTCCATCATGGAGAGCCGCCTGGATCAAA
GGGAAAGCTCCAAACTTCCCAACTTGAAGACTGGCTTCCATCTGGATCCCAAACAAATTG
AGCATTCTCTTCAAGCTTGTACCTTTAACATGAAGATCTGGAACCAAAATACAAGGGGAT
AGACAAGGTGTGCATGCCTTAGAACGGGTCCGTGGGCCCACATAAGCCAAACAGCACTCC
AAAGCTTGGGAAACTCTTGTCACACCATCATGATCAGGAGCGGTACCTTTCAAAAGGTAC
TGAAAAGCATGCATCCCCACAGAGAGGCATACGAATCCCTTAAGGATATCAGAGGCATCC
GCATAAGCCAACAGCTCCCTTGGAACATCTGTGACCAACTCAAGAGGAACTCCCTCATCA
AGCAAACGATCTAGATCCTCATAAGTAACTTCTTCAAGCATACTAGTATCAAAGGGAGAA
GAAGGAGGTACATAATCACCCTCTTCTGATAAGAGACTGTCAA