CL2778Contig1
Contig ID CL2778Contig1
Length 767
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2778contig1 sequence.
Clone ID BP919333 DK962686
Sequence
ACGGAAAGCTAAGAGACTTCTTTCACAAGAATTTCGACGCCCCCCACGAGAGAGTGATGT
GGCAGAGCTAATGGGGATGACTGTGGAAAAATTGAGGTCAATATCCAGGTCTACTAAGGT
GTGCAAGTCTTTGGAGAAGCCAGTTGGCAAAGATCTGAACACCACCTTAGGGGACTTCAT
AGCTGATGAGACACTTGAAGATCCAGAATCAAAAATCATGAAGCAGCTGTTAAAGCAGGA
TGTGAAAAAGGTCTTAAAAACTCTCACAGAAAGAGAAAAAACTGTGATGATATTGAGATA
TGGGCTTGAAGATGGAAAAATGAGGACCTTAGAAGAGATTGGCAAGTTTTTTGATGTGAC
CAGGGAGAGAGTCCGTCAGATAGAGGCGAAGGCAATGCGAAAGCTGAAGCAGCCGGAAAG
GAACCAAGTACTGAAAGGGTATATGGGTGCTGATCTATGATGCACTTTGTGGAGAGTAAC
AATTTCCTTTTGTAAATTTGTAATAGCCTTGATAGATTGGATTTTATCCCCATGCTCTTC
TACGTTACTCAACACAGTATACCTAAGCCAGATGCTTTTGTAGTGCTCTGTGGATGGGAA
ATTATTTGCGGATTGGCCATCTTCACAAACACATTTAACAAGTCCAACTGCAGCATTTGG
GAAGTTCAAAAATGAAATTATGGGAACCTTTGCGCCAAGCAAACATGTTAATTTTCTTTC
TACCTTCCTTTTCTTGGGAGCCTGCCAAAATTTTGTTTTTTTTTCCC