CL4001Contig1
Contig ID CL4001Contig1
Length 542
Number of clones 2
Definition Adiantum capillus-veneris contig: CL4001contig1 sequence.
Clone ID BP916160 BP921406
Sequence
ATCGTAACATTTAAACTTGATTATATTGAATCAAATAGCTATACATGCGAGAGTTCTTGT
CCGTTTTAACATCACTTTTTTCTTTCCCAAGATTTTTGAGAAACACCTATCTATACATCT
CTGCCTCGCTTTCACGAAACCGCTAAGGTGCAGCAACAAGACGCAGCAACGAGGCTCAGG
CTAGTCCTGAAAAGAGCACAGGATTGCACTAGCTGGCTGCTGCTGTCTTCAAATTCCCCT
TTACAAGATGTTGAATGATACAAACAAAACTGTAGTATTGGCCTGTGCACATTATAATGA
TCAATTGTGTAGCCAATCTTCTTTCGCTGCAACGTGCTTGATCGGCCAATCACGCTTATA
AACATTTGCATTTTCTCTAGACAAAATTTAGCACTAGCAGCTGAGCTAATCCCTTTTCTG
ATTTTCAACAAAGAGGTGAATAAGTGGTGCAATAGATGACCCGTGCCACTTCCACCAAGA
GTGTCTATAAGATGGCTTGTTCAAGAATGTATGTACAATATAGAGTACCGCTCATCCTCC
CG