CL816Contig1
Contig ID CL816Contig1
Length 1374
Number of clones 4
Definition Adiantum capillus-veneris contig: CL816contig1 sequence.
Clone ID BP915798 BP920302 BP915414 DK959461
Sequence
GTTTATATGTAGAATGAAGAGTTTTGTTTGGGTCAGCACCATGATCCGTTCTTTTGAAGT
TGATAGGAATAAATGAGAGGTAGAGAGCTATAGAGAAACAGAAAAGAGAGCAAGTTAGGG
CTACTTCCCCACGGAGGATCGGGATCCAGTACCTTTAGTTTACAATGGTCGTATGCTACA
TGTGATCCCAGATCGATATGGCTCCAAGCAGATTCTTCACAGGTGGTTGGCATGAAGAGA
TAGTGGCATGGTTTCACCTTCTGGAGTACAAGTTTGCTTAATTCGGGGATTTATGACGAT
GAGTTGCAAGCCAAGTATGCATGGCATAGGGTTTTCTATATGATGCACGCTACCTTTATT
CCATGTTGTCCGAGCAAGAACAATGGAGTTGGCAAAGCATGAAAAGAGCTCTTTTCCTAG
CTTTTTATGATCCTCCAGAGATTTTTTGTGATATTGAGAATGGTTGTCATCTCATCAAGG
CTTCGGAGAGAGCTGCATGCACAGTATTGGGAGAGCTTGGAGACCTCAGCATCTCAGGTT
TTCTTGCCACATGATGGGTTTGCTTTTGATATGCATGATGGCATTGTTACACTTCATGGA
GAGGGTTATGAGAGCGACGAAGAAGCATCTTCATGTAGTGAAGGTGGGGGAAATGTTGAT
GACAAGTTAAAGTCTACAGAGAGCACTAGTGACCTATCACCAGATGGAGGTGACATGGAA
GTAATGCATGAGGAGTAAAATGGTTTAACTGTTGCAGAAGATATGTATGATGTTGTGTAT
GAGGATGCTTTGGAGCTTAAATCACAGCAAGAGGGAGAGCAAGCTCTTGTCTCTCATGAG
AAATGTATGCAACCAGTAGCAGAGAAGAGTGGGAATGCTTCAGTTGAAGAGGTTATGAGT
TTTTGTGATGGTGAGAGTGTATGCACAGAGGTGGTACATGTTGAGAGTATGTTTGATGAT
GGAGTTGATAATCTTAGTTTTTTTGATAGCCTCATGCCTGAAGCAGTAGATGATATGTCT
TTCTCTTCTTCCTTTGATACTGGCATGCCGGAAAATGCTACTTGTGAGTTTTTTGATCGT
CTGCTGGATGAAGAAGTACCTCTTGCATAAATTATGGGTGCTCCAAAGAAAGATGATTCT
TGTGCAGATGCCTTCAAGGTGTTCAAGGGTTTTGTATGCCTCTTTGCAGGGATGTATGCG
TTTCAATGCCTTTTGAAGGCTGCTTCTGTTGCTCATGATGATGCTTCAGGTGTTTTCAAG
ACTTTGGAATGCAATATACCCTATGTTGGCCTGAATATGGTTTTTTGTGCAGAGGATAAC
AACGAAGCTCGTTTTATGATGCACAGGCAGGTCGATGGCAGACTTATTGATGGT