CL1053Contig1
Contig ID CL1053Contig1
Length 711
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1053contig1 sequence.
Clone ID BP918882 BP914541 BP915450
Sequence
GCAGGCTGTCCAACTCTACTAGGCCATAGAAACTTCCTAAAAAGTGGTTGAATCTGGCCT
ATGTAGGAGCTCAAAAAAATCTAACAAGAAGCGATGTACCACATTGTTGCCAAAAGCACC
TCATCGTTGCACCTGATTGGCAACCACAGACCGACGTGTCAGGGAGTGTTGAGCCAAACT
TCAGTGTAGAAGCACCCTCTGAATGTGCAGGAGGGGGGCAAGCTGCTGCTCGTGTCAAGT
CAGGGCAACCTGGCAGCCGAAGTATCGCACTGACATCTGCGGTGGAATCCATATAATGCC
CTCACCACAAGACCATCTGGAGTGGTCGACCGACCAATCCAAATTGCAATTGTCTTGTAG
CAATTGATCGGCACACCCACCAACGACCTCAAGAGTCTACTGGCCCCTAAGCATATTGGT
CTCACAGCCATCCAAATACAATGCAATGCCATCAACAAACTCCTCACGTATAGGCATATG
CAGTCCTCAAAGCTTAACCTCCTCAACAGTGACATAGCTACTCAAGGCCTCTGCAAAGAA
TAGCAGCAAGATAGGCGCAAAAGAGCATTGATGTCTGACAGATTTGGTCAATACAAACCT
CAGACCTCTCCCCTTGTCAATCAGCACCTGGATATGGGTTAGTGGAGTACAGTGCTGTAA
CCCGCCTGAATTGGGCCTCCGGGAAACCTATCCTTAGCATTTCTCCTCTAG