CL1069Contig1
Contig ID CL1069Contig1
Length 591
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1069contig1 sequence.
Clone ID BP917473 BP921554 BP921114
Sequence
ATTTGCAGGTGCAGGATCTCAGGCAGGGCGTACAAGGGACAGCCGTGGCAGAGCCAAGTG
TGAGTGAGCTGGAGGCAGCTCGAGAGGAGGGAAGGCAGGAAGCTGCAAAGGAGAGTGAAG
CAGAGCTGAATGATCTGCTTGTATGTCTTGGGCAGGAGGAAAGCAAGGTCGAGAGGCTGA
GGACACGCTTGGAAGAATTGGGTGAGGATGTTCAGGCATTGCTTCAGGGAATTGGTGAGG
AACCTGAAGGAGAACAGGTTGGAGAAGAGTCGTAAAGGCAAAAACATGTCAGAATTTGCA
CACTGTTTGTCTGTGGTTTCTTATCTGGGGTTTACAAGTCCTCCTCACTGGTTGAACTCT
CAGCCCTATCATCGCGTGGGACTTGGTGGATCTATACCCTTGTATGGAATGTATAGAGCC
TCTACAACTCCAGTGACCAAGTTCTTACCAGTCCTGATGGCATTTATTAGCTATTAGTAT
GACCCTCCAGCTGTATATTAAGTTGCTTGTCATTTTGATGTTTTAGAGAGCTAACATATT
TCTCATTTGATTAGTCTCTGATAACAAGCTTTTCTCTGCCTTAAAAAAAAA