CL176Contig1
Contig ID CL176Contig1
Length 565
Number of clones 12
Definition Adiantum capillus-veneris contig: CL176contig1 sequence.
Clone ID DK963386 DK943628 DK943808 DK961799 DK944682 DK952597 DK947732 DK957715 DK948248 DK943835 DK946565 DK947585
Sequence
GATACTTTTAGGGCTTTTGCAAGTGAGGCTTTTCTTCTCTGCTGCGTTGCCTAGCGTTGC
TAAATCTCGCGCTCGCGCTCTGCTACCGGGCCTCCAGATATGGATTCGCCTGTTAAGCTT
GCCATTGTGGTGAAAGTCATGGGGCGGACTGGCTCCCGAGGTCAAGTGACTCAAGTGAGG
GTCAAGTTTGTCGATGACCAAAATCGTCTCATCATGAGAAATGTGAAAGGTCCTGTCCGA
GAAGGAGATATCCTAGCTCTTTTGGAGTCTGAGAGAGAGGCTCGAAGACTTCGATAGCTG
TGGTGGTTTTTTGATGGTTCGAATGGGCTATTGTCATGGATCATAAGTTGGAAAAGCATT
TTGGAGAGTACGGCCGGTTATAGGATGATAGGCTTGCTGTTTTGGCAACAACTTAATCAT
GTTTTTGACAATGCGGCATGTGCTTCTATGTAACATGAGTTTTTCAGATTGATGAGAATC
AAGTATTGTTTTTAGTATTTCCTTATTTGACACTTGTATTCAGAGTTTTTTTTATAAGAG
CATGTGCGTGTCACTGGGATTTTGC